Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
mmu_circRNA_44123 | |||
Gene | n/a | Organism | Mouse |
Genome Locus | n/a | Build | n/a |
Disease | Osteogenesis | ICD-10 | Osteogenesis imperfecta (Q78.0) |
DBLink | Link to database | PMID | 29700558 |
Experimental Method | |||
Sample Type | Mouse Adipose-Derived Stromal Cells | Comparison | Osteogenic Differentiation of mADSCs at Different Stages |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GTGAACTCTGCGGAAAACGG ReverseGGTGGGGCGGTGTAGATGT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Long, T, Guo, Z, Han, L, Yuan, X, Liu, L, Jing, W, Tian, W, Zheng, XH, Tang, W, Long, J (2018). Differential Expression Profiles of Circular RNAs During Osteogenic Differentiation of Mouse Adipose-Derived Stromal Cells. Calcif. Tissue Int., 103, 3:338-352. |